Review



superscript ii rnase-h-reverse transcriptase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher superscript ii rnase-h-reverse transcriptase
    Superscript Ii Rnase H Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+ii+rnase+h+reverse+transcriptase/pm38994968-104-33-37
    Average 90 stars, based on 1 article reviews
    superscript ii rnase-h-reverse transcriptase - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: Bacterial Ribosomes Induce Plasticity in Mouse Adult Fibroblasts
    Article Snippet: Total RNA of Control-MAF and RICs-MAF were purified at D14 and D21 (after differentiation) using the RNeasy Plus Mini Kit (Qiagen, Germantown, MD, USA), following the manufacturer’s protocol. .. Next, each cDNA was synthesized using 500 ng RNA, Oligo (dt) primers (Life Technologies), dNTP (deoxynucleotide triphosphate, Invitrogen, Carlsbad, CA, USA), 5× First Strand buffer (Invitrogen) and 0.1 M DTT (dithiothreitol, Invitrogen) and SuperScript II Rnase-H-Reverse Transcriptase (Thermo Fisher). ..

    Reverse Transcription:

    Article Title: Involvement of Inflammatory Cytokines, Renal NaPi-IIa Cotransporter, and TRAIL Induced-Apoptosis in Experimental Malaria-Associated Acute Kidney Injury.
    Article Snippet: The total RNA was quantified by measuring the absorbance at 260 nm on a GeneQuant spectrophotometer (GE Healthcare, Chicago, IL, USA). .. Total RNA samples were treated with DNase I (Invitrogen, Gaithersburg, MD, USA) and reverse-transcribed into cDNA using SuperScript II RNase H reverse transcriptase (Invitrogen, Gaithersburg, MD, USA) according to Lima and colleagues [40]. .. Specific primers were designed using Beacon Designer 2.0 (Premier Biosoft International, Palo Alto, CA, USA; Supplementary Table S1).

    Article Title: RGS10 mitigates high glucose-induced microglial inflammation via the reactive oxidative stress pathway and enhances synuclein clearance in microglia.
    Article Snippet: The RNAs were quantified using the NanoDrop and their integrities were further confirmed by locating the 18S and 28S bands on a 2% agarose gel. .. One microgram of total RNA was isolated from cells in culture using the AurumTM Total RNA Mini Kit (BioRad), treated with DNaseI, and reverse transcribed using Superscript II Rnase H-reverse transcriptase (Invitrogen). .. QPCR was performed using SYBR Green in a 384-well format using a QuantStudioTM 6 Flex (Thermo Fisher Scientific).

    Article Title: STARD7 maintains intestinal epithelial mitochondria architecture, barrier integrity, and protection from colitis.
    Article Snippet: .. A total of 1 μg of the purified RNA was reverse-transcribed to cDNA using Superscript II RNase H Reverse Transcriptase (Thermo Fisher Scientific): STARD7 (primer: 5′ AGGAGGAGTTGCAGAGATCTATTA 3′; reverse 5′ GTGTAGGTTCCAAAAACTCGG 3′) and hypoxanthine phosphoribosyl transferase (HPRT) (primer: forward 5′ CAGACTGAAGAGCTATTGTAATG 3′; reverse 5′ CCAGTGTCAATTATATCTTCCAC 3′). mRNA levels were quantified by real-time quantitative PCR with the CFX Duet Real-Time PCR System (Bio-Rad Laboratories) using IQ SYBR Green Supermix (Bio-Rad Laboratories). ..

    Article Title: Methylation of KRAS by SETD7 promotes KRAS degradation in non-small cell lung cancer.
    Article Snippet: Full-length human SETD7 and KRAS cDNA sequences were amplified by Q5 DNA polymerase from a human mRNA pool generated by RT-PCR using SuperScript II RNase H Reverse Transcriptase (Life Technologies, CA, USA). .. Full-length human SETD7 and KRAS cDNA sequences were amplified by Q5 DNA polymerase from a human mRNA pool generated by RT-PCR using SuperScript II RNase H Reverse Transcriptase (Life Technologies, CA, USA). ..

    Article Title: Laxiflorin B covalently binds the tubulin colchicine-binding site to inhibit triple negative breast cancer proliferation and induce apoptosis.
    Article Snippet: Laxiflorin B is a natural ent-kaurane diterpenoid that can be isolated from the leaves of the Isodon eriocalyx var. laxiflora, a perennial shrub native to parts of China.. While this compound has potent cytotoxic activity against various tumor cells, the anti-tumor targets and molecular mechanisms of Laxiflorin B are unclear.. Here, we show that Laxiflorin B exhibits strong antiproliferative and proapoptotic effects on triple-negative breast cancer (TNBC) cells.

    Article Title: IL-13-induced STAT3-dependent signaling networks regulate esophageal epithelial proliferation in eosinophilic esophagitis.
    Article Snippet: Sahiti Marella, BS, Ankit Sharma, PhD, Varsha Ganesan, MS, Daysha Ferrer-Torres, PhD, James W. Krempski, PhD, Gila Idelman, PhD, Sydney Clark, BS, Zena Nasiri, Simone Vanoni, PhD, Chang Zeng, PhD, Andrej A. Dlugosz, MD, Haibin Zhou, PhD, Shaomeng Wang, PhD, Alfred D. Doyle, PhD, Benjamin L. Wright, MD, Jason R. Spence, PhD, Mirna Chehade, MD, MPH, and Simon P. Hogan, PhD Ann Arbor, Mich; Cincinnati, Ohio; Scottsdale and Phoenix, Ariz; and New York, NY

    Article Title: PI3P-dependent regulation of cell size and autophagy by phosphatidylinositol 5-phosphate 4-kinase
    Article Snippet: RNA was extracted from Drosophila S2R+ cells using TRIzol reagent (15596018; Life Technologies). .. Purified RNA was treated with amplification grade DNase I (18068015; Thermo Fisher Scientific). cDNA conversion was done using SuperScript II RNase H– Reverse Transcriptase (18064014; Thermo Fisher Scientific) and random hexamers (N8080127; Thermo Fisher Scientific). .. Quantitative PCR (qPCR) was performed using Power SybrGreen PCR master-mix (4367659; Applied Biosystems) in an Applied Biosystem 7500 Fast Real Time PCR instrument.

    Isolation:

    Article Title: RGS10 mitigates high glucose-induced microglial inflammation via the reactive oxidative stress pathway and enhances synuclein clearance in microglia.
    Article Snippet: The RNAs were quantified using the NanoDrop and their integrities were further confirmed by locating the 18S and 28S bands on a 2% agarose gel. .. One microgram of total RNA was isolated from cells in culture using the AurumTM Total RNA Mini Kit (BioRad), treated with DNaseI, and reverse transcribed using Superscript II Rnase H-reverse transcriptase (Invitrogen). .. QPCR was performed using SYBR Green in a 384-well format using a QuantStudioTM 6 Flex (Thermo Fisher Scientific).

    Purification:

    Article Title: STARD7 maintains intestinal epithelial mitochondria architecture, barrier integrity, and protection from colitis.
    Article Snippet: .. A total of 1 μg of the purified RNA was reverse-transcribed to cDNA using Superscript II RNase H Reverse Transcriptase (Thermo Fisher Scientific): STARD7 (primer: 5′ AGGAGGAGTTGCAGAGATCTATTA 3′; reverse 5′ GTGTAGGTTCCAAAAACTCGG 3′) and hypoxanthine phosphoribosyl transferase (HPRT) (primer: forward 5′ CAGACTGAAGAGCTATTGTAATG 3′; reverse 5′ CCAGTGTCAATTATATCTTCCAC 3′). mRNA levels were quantified by real-time quantitative PCR with the CFX Duet Real-Time PCR System (Bio-Rad Laboratories) using IQ SYBR Green Supermix (Bio-Rad Laboratories). ..

    Article Title: IL-13-induced STAT3-dependent signaling networks regulate esophageal epithelial proliferation in eosinophilic esophagitis.
    Article Snippet: Sahiti Marella, BS, Ankit Sharma, PhD, Varsha Ganesan, MS, Daysha Ferrer-Torres, PhD, James W. Krempski, PhD, Gila Idelman, PhD, Sydney Clark, BS, Zena Nasiri, Simone Vanoni, PhD, Chang Zeng, PhD, Andrej A. Dlugosz, MD, Haibin Zhou, PhD, Shaomeng Wang, PhD, Alfred D. Doyle, PhD, Benjamin L. Wright, MD, Jason R. Spence, PhD, Mirna Chehade, MD, MPH, and Simon P. Hogan, PhD Ann Arbor, Mich; Cincinnati, Ohio; Scottsdale and Phoenix, Ariz; and New York, NY

    Article Title: PI3P-dependent regulation of cell size and autophagy by phosphatidylinositol 5-phosphate 4-kinase
    Article Snippet: RNA was extracted from Drosophila S2R+ cells using TRIzol reagent (15596018; Life Technologies). .. Purified RNA was treated with amplification grade DNase I (18068015; Thermo Fisher Scientific). cDNA conversion was done using SuperScript II RNase H– Reverse Transcriptase (18064014; Thermo Fisher Scientific) and random hexamers (N8080127; Thermo Fisher Scientific). .. Quantitative PCR (qPCR) was performed using Power SybrGreen PCR master-mix (4367659; Applied Biosystems) in an Applied Biosystem 7500 Fast Real Time PCR instrument.

    Real-time Polymerase Chain Reaction:

    Article Title: STARD7 maintains intestinal epithelial mitochondria architecture, barrier integrity, and protection from colitis.
    Article Snippet: .. A total of 1 μg of the purified RNA was reverse-transcribed to cDNA using Superscript II RNase H Reverse Transcriptase (Thermo Fisher Scientific): STARD7 (primer: 5′ AGGAGGAGTTGCAGAGATCTATTA 3′; reverse 5′ GTGTAGGTTCCAAAAACTCGG 3′) and hypoxanthine phosphoribosyl transferase (HPRT) (primer: forward 5′ CAGACTGAAGAGCTATTGTAATG 3′; reverse 5′ CCAGTGTCAATTATATCTTCCAC 3′). mRNA levels were quantified by real-time quantitative PCR with the CFX Duet Real-Time PCR System (Bio-Rad Laboratories) using IQ SYBR Green Supermix (Bio-Rad Laboratories). ..

    Article Title: IL-13-induced STAT3-dependent signaling networks regulate esophageal epithelial proliferation in eosinophilic esophagitis.
    Article Snippet: Sahiti Marella, BS, Ankit Sharma, PhD, Varsha Ganesan, MS, Daysha Ferrer-Torres, PhD, James W. Krempski, PhD, Gila Idelman, PhD, Sydney Clark, BS, Zena Nasiri, Simone Vanoni, PhD, Chang Zeng, PhD, Andrej A. Dlugosz, MD, Haibin Zhou, PhD, Shaomeng Wang, PhD, Alfred D. Doyle, PhD, Benjamin L. Wright, MD, Jason R. Spence, PhD, Mirna Chehade, MD, MPH, and Simon P. Hogan, PhD Ann Arbor, Mich; Cincinnati, Ohio; Scottsdale and Phoenix, Ariz; and New York, NY

    SYBR Green Assay:

    Article Title: STARD7 maintains intestinal epithelial mitochondria architecture, barrier integrity, and protection from colitis.
    Article Snippet: .. A total of 1 μg of the purified RNA was reverse-transcribed to cDNA using Superscript II RNase H Reverse Transcriptase (Thermo Fisher Scientific): STARD7 (primer: 5′ AGGAGGAGTTGCAGAGATCTATTA 3′; reverse 5′ GTGTAGGTTCCAAAAACTCGG 3′) and hypoxanthine phosphoribosyl transferase (HPRT) (primer: forward 5′ CAGACTGAAGAGCTATTGTAATG 3′; reverse 5′ CCAGTGTCAATTATATCTTCCAC 3′). mRNA levels were quantified by real-time quantitative PCR with the CFX Duet Real-Time PCR System (Bio-Rad Laboratories) using IQ SYBR Green Supermix (Bio-Rad Laboratories). ..

    Article Title: IL-13-induced STAT3-dependent signaling networks regulate esophageal epithelial proliferation in eosinophilic esophagitis.
    Article Snippet: Sahiti Marella, BS, Ankit Sharma, PhD, Varsha Ganesan, MS, Daysha Ferrer-Torres, PhD, James W. Krempski, PhD, Gila Idelman, PhD, Sydney Clark, BS, Zena Nasiri, Simone Vanoni, PhD, Chang Zeng, PhD, Andrej A. Dlugosz, MD, Haibin Zhou, PhD, Shaomeng Wang, PhD, Alfred D. Doyle, PhD, Benjamin L. Wright, MD, Jason R. Spence, PhD, Mirna Chehade, MD, MPH, and Simon P. Hogan, PhD Ann Arbor, Mich; Cincinnati, Ohio; Scottsdale and Phoenix, Ariz; and New York, NY

    Amplification:

    Article Title: Methylation of KRAS by SETD7 promotes KRAS degradation in non-small cell lung cancer.
    Article Snippet: Full-length human SETD7 and KRAS cDNA sequences were amplified by Q5 DNA polymerase from a human mRNA pool generated by RT-PCR using SuperScript II RNase H Reverse Transcriptase (Life Technologies, CA, USA). .. Full-length human SETD7 and KRAS cDNA sequences were amplified by Q5 DNA polymerase from a human mRNA pool generated by RT-PCR using SuperScript II RNase H Reverse Transcriptase (Life Technologies, CA, USA). ..

    Article Title: Laxiflorin B covalently binds the tubulin colchicine-binding site to inhibit triple negative breast cancer proliferation and induce apoptosis.
    Article Snippet: Laxiflorin B is a natural ent-kaurane diterpenoid that can be isolated from the leaves of the Isodon eriocalyx var. laxiflora, a perennial shrub native to parts of China.. While this compound has potent cytotoxic activity against various tumor cells, the anti-tumor targets and molecular mechanisms of Laxiflorin B are unclear.. Here, we show that Laxiflorin B exhibits strong antiproliferative and proapoptotic effects on triple-negative breast cancer (TNBC) cells.

    Article Title: IL-13-induced STAT3-dependent signaling networks regulate esophageal epithelial proliferation in eosinophilic esophagitis.
    Article Snippet: Sahiti Marella, BS, Ankit Sharma, PhD, Varsha Ganesan, MS, Daysha Ferrer-Torres, PhD, James W. Krempski, PhD, Gila Idelman, PhD, Sydney Clark, BS, Zena Nasiri, Simone Vanoni, PhD, Chang Zeng, PhD, Andrej A. Dlugosz, MD, Haibin Zhou, PhD, Shaomeng Wang, PhD, Alfred D. Doyle, PhD, Benjamin L. Wright, MD, Jason R. Spence, PhD, Mirna Chehade, MD, MPH, and Simon P. Hogan, PhD Ann Arbor, Mich; Cincinnati, Ohio; Scottsdale and Phoenix, Ariz; and New York, NY

    Article Title: PI3P-dependent regulation of cell size and autophagy by phosphatidylinositol 5-phosphate 4-kinase
    Article Snippet: RNA was extracted from Drosophila S2R+ cells using TRIzol reagent (15596018; Life Technologies). .. Purified RNA was treated with amplification grade DNase I (18068015; Thermo Fisher Scientific). cDNA conversion was done using SuperScript II RNase H– Reverse Transcriptase (18064014; Thermo Fisher Scientific) and random hexamers (N8080127; Thermo Fisher Scientific). .. Quantitative PCR (qPCR) was performed using Power SybrGreen PCR master-mix (4367659; Applied Biosystems) in an Applied Biosystem 7500 Fast Real Time PCR instrument.

    Generated:

    Article Title: Methylation of KRAS by SETD7 promotes KRAS degradation in non-small cell lung cancer.
    Article Snippet: Full-length human SETD7 and KRAS cDNA sequences were amplified by Q5 DNA polymerase from a human mRNA pool generated by RT-PCR using SuperScript II RNase H Reverse Transcriptase (Life Technologies, CA, USA). .. Full-length human SETD7 and KRAS cDNA sequences were amplified by Q5 DNA polymerase from a human mRNA pool generated by RT-PCR using SuperScript II RNase H Reverse Transcriptase (Life Technologies, CA, USA). ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Methylation of KRAS by SETD7 promotes KRAS degradation in non-small cell lung cancer.
    Article Snippet: Full-length human SETD7 and KRAS cDNA sequences were amplified by Q5 DNA polymerase from a human mRNA pool generated by RT-PCR using SuperScript II RNase H Reverse Transcriptase (Life Technologies, CA, USA). .. Full-length human SETD7 and KRAS cDNA sequences were amplified by Q5 DNA polymerase from a human mRNA pool generated by RT-PCR using SuperScript II RNase H Reverse Transcriptase (Life Technologies, CA, USA). ..

    Article Title: Laxiflorin B covalently binds the tubulin colchicine-binding site to inhibit triple negative breast cancer proliferation and induce apoptosis.
    Article Snippet: Laxiflorin B is a natural ent-kaurane diterpenoid that can be isolated from the leaves of the Isodon eriocalyx var. laxiflora, a perennial shrub native to parts of China.. While this compound has potent cytotoxic activity against various tumor cells, the anti-tumor targets and molecular mechanisms of Laxiflorin B are unclear.. Here, we show that Laxiflorin B exhibits strong antiproliferative and proapoptotic effects on triple-negative breast cancer (TNBC) cells.

    Expressing:

    Article Title: IL-13-induced STAT3-dependent signaling networks regulate esophageal epithelial proliferation in eosinophilic esophagitis.
    Article Snippet: Sahiti Marella, BS, Ankit Sharma, PhD, Varsha Ganesan, MS, Daysha Ferrer-Torres, PhD, James W. Krempski, PhD, Gila Idelman, PhD, Sydney Clark, BS, Zena Nasiri, Simone Vanoni, PhD, Chang Zeng, PhD, Andrej A. Dlugosz, MD, Haibin Zhou, PhD, Shaomeng Wang, PhD, Alfred D. Doyle, PhD, Benjamin L. Wright, MD, Jason R. Spence, PhD, Mirna Chehade, MD, MPH, and Simon P. Hogan, PhD Ann Arbor, Mich; Cincinnati, Ohio; Scottsdale and Phoenix, Ariz; and New York, NY

    Software:

    Article Title: IL-13-induced STAT3-dependent signaling networks regulate esophageal epithelial proliferation in eosinophilic esophagitis.
    Article Snippet: Sahiti Marella, BS, Ankit Sharma, PhD, Varsha Ganesan, MS, Daysha Ferrer-Torres, PhD, James W. Krempski, PhD, Gila Idelman, PhD, Sydney Clark, BS, Zena Nasiri, Simone Vanoni, PhD, Chang Zeng, PhD, Andrej A. Dlugosz, MD, Haibin Zhou, PhD, Shaomeng Wang, PhD, Alfred D. Doyle, PhD, Benjamin L. Wright, MD, Jason R. Spence, PhD, Mirna Chehade, MD, MPH, and Simon P. Hogan, PhD Ann Arbor, Mich; Cincinnati, Ohio; Scottsdale and Phoenix, Ariz; and New York, NY



    Similar Products

    90
    Thermo Fisher superscript ii rnase-h-reverse transcriptase
    Superscript Ii Rnase H Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+ii+rnase+h+reverse+transcriptase/pm38994968-104-33-37
    Average 90 stars, based on 1 article reviews
    superscript ii rnase-h-reverse transcriptase - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript ii rnase h 2 reverse transcriptase
    Superscript Ii Rnase H 2 Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+ii+rnase+h+reverse+transcriptase/Ribonuclease+A/pmc12664216-50-17-24
    Average 99 stars, based on 1 article reviews
    superscript ii rnase h 2 reverse transcriptase - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript ii rnase h reverse transcriptase kit
    Superscript Ii Rnase H Reverse Transcriptase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+ii+rnase+h+reverse+transcriptase/Ribonuclease+A/pm40930097-44-32-39
    Average 99 stars, based on 1 article reviews
    superscript ii rnase h reverse transcriptase kit - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    90
    Promega superscript ii rnase h-reverse transcriptase
    Superscript Ii Rnase H Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+ii+rnase+h+reverse+transcriptase/superscript+ii+reverse+transcriptase/10__1016_slash_j__aquaculture__2025__742876-155-15-20
    Average 90 stars, based on 1 article reviews
    superscript ii rnase h-reverse transcriptase - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript ii rnase h reverse transcriptase
    Superscript Ii Rnase H Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+ii+rnase+h+reverse+transcriptase/superscript+ii+rnase+h+reverse+transcriptase/pm39576011-286-14-20
    Average 90 stars, based on 1 article reviews
    superscript ii rnase h reverse transcriptase - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript ii rnase h-reverse transcriptase
    Superscript Ii Rnase H Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+ii+rnase+h+reverse+transcriptase/10__1007_slash_s11816___024___00929___x-68-21-26
    Average 90 stars, based on 1 article reviews
    superscript ii rnase h-reverse transcriptase - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript ii rnase h‐reverse transcriptase
    Superscript Ii Rnase H‐Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+ii+rnase+h+reverse+transcriptase/pmc11366968-71-25-33
    Average 90 stars, based on 1 article reviews
    superscript ii rnase h‐reverse transcriptase - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results